![]() If you want to look at the actual alignment, double click on the row in the table.Īlong the top of the main window is a strip of ‘tabs’:Įach of these has settings and options and in general you should work from left to right (although not all the tabs will be relevant to all analyses). Once loaded, the alignment will be displayed in the main window in a table: Siamang AGAAATACGTCTGACGAAAGAGTTACTTTGATAGAGTAAATAACAGGGGT.īEAST can also import FASTA files (as long as the sequences have been aligned) or BEAST XML files (in which case the data will imported but the models and settings will not). ![]() Orangutan AGAAATATGTCTGACAAAAGAGTTACTTTGATAGAGTAAAAAATAGAGGT. Gorilla AGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGAGGT. Human AGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGAGC.Ĭhimp AGAAATATGTCTGATAAAAGAATTACTTTGATAGAGTAAATAATAGGAGT.īonobo AGAAATATGTCTGATAAAAGAATTACTTTGATAGAGTAAATAATAGGAGT.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |